Primer

Der Titel dieses Artikels ist mehrdeutig. Weitere Bedeutungen sind unter Primer (Begriffsklärung) aufgeführt.

Als Primer (Pl.: die Primer; IPA: [ˊpʁaɪ̯mɐ]) wird in der Molekularbiologie ein Oligonukleotid bezeichnet, das als Startpunkt für DNA-replizierende Enzyme wie die DNA-Polymerase dient.

DNA-Polymerasen benötigen eine Hydroxygruppe als Startpunkt für ihre erste Verknüpfungsreaktion. Primer stellen mit ihrem 3'-OH-Ende eine passende Hydroxyfunktion zur Verfügung. Primer können sowohl aus DNA als auch aus RNA bestehen. Bei der Replikation dient in Prokaryoten und Eukaryoten RNA als Primermaterial. In Prokaryoten synthetisiert die Primase, auch als DnaG-Protein bezeichnet, die Primersequenzen. In Eukaryoten besitzt die DNA-Polymerase α eine Primasefunktion. Einen Sonderfall stellt die DNA-Synthese an den Telomeren eukaryotischer Zellen dar. Hier dient dem polymerisierendem Enzym Telomerase das 3'-OH-Ende der DNA als Primersequenz. Bei Prokaryoten werden die bei der Replikation auftauchenden Primer durch 5'-3'-Exonukleaseaktivität der Polymerase I oder durch die RNase H entfernt. In eukaryotischen Zellen werden die Primer durch verdrängende DNA-Synthese der Polymerase δ und Restriktion durch die Flap-Endonuklease entfernt.

Auch bei der In-vitro-Amplifikation von DNA, beispielsweise bei der Polymerase-Kettenreaktion (PCR), der DNA-Sequenzierung oder bei der reversen Transkription, werden Primer benötigt. Hier lässt sich mit Hilfe der Primer der spezifische DNA-Abschnitt, der amplifiziert werden soll, festlegen.

Für die PCR werden deshalb Nukleotidsequenzen, die den zu amplifizierenden DNA-Abschnitt flankieren, bestimmt. Gemäß diesen Sequenzen werden nun passende Primersequenzen synthetisch hergestellt. Ein Primer repräsentiert hierbei jeweils den gegenläufigen Strang zu seinem „Primerpartner“. Primer für PCR-Ansätze haben in der Regel eine Länge von 18-30 Nukleotiden. Diverse Biotechnologiefirmen bieten mittlerweile maßgeschneiderte Primer für molekularbiologische Anwendungen an. Durch maßgeschneiderte Missmatchprimer lassen sich über die PCR-Technik auch gezielt Mutationen in Gene einführen, die z.B. im Austausch einer Aminosäure bestehen.

Primerdesign

Primer werden mit dem Ziel designt, an spezifischer Stelle mit dem DNA-Template zu binden und so gezielte PCR-Produkte oder Hybridisierungen zu ermöglichen. Nebst den Reaktionsbedingungen (Temperatur, Puffer, Konzentrationen von Template und Primer) spielt auch der Aufbau des Primers selbst eine entscheidende Rolle. Die Schmelztemperatur (TM) eines Primers hängt von seiner Länge und seiner Zusammensetzung (GC-Gehalt) ab. Die Länge des Primers (typisch 18 bis 30 Nukleotide) wird so gewählt, dass seine Schmelztemperatur passend zur Annealing-Temperatur des PCR- oder Hybridisierungs-Prozesses ist (siehe Ablauf einer PCR-Reaktion). Der GC-Gehalt spielt eine besondere Rolle, da die Doppelhelix durch eine hohe Anzahl aufeinander folgender GC-Paarungen auf Grund von Stapelwechselwirkungen stabiler ist. Die Schmelztemperatur nimmt also mit der Anzahl an G- und C-Nukleotiden zu. Die Schmelztemperatur (in Grad Celsius) lässt sich mit mehreren Methoden berechnen:

  • die Wallace-Regel:
    $ T_\mathrm{M} = 2 \cdot (A+T)+4 \cdot (G+C) $
  • die GC-Methode ist die einfachste aber auch ungenaueste Methode:
    $ T_M=64+41\frac{G+C-16{,}4}{A+G+C+T} $
  • die „salt adjusted“-Methode ist etwas genauer und bezieht die Konzentration an Na+-Ionen im Reaktionsansatz mit ein:
    $ T_\mathrm{M}=100,5+41 \cdot \frac{C+G}{A+C+G+T}-\frac{820}{A+C+G+T} \cdot 16{,}6 \cdot \log_{10}([\mbox{Na}^+]) $
  • die komplizierteste Methode ist die „base stacking“-Methode, bei der die Enthalpie- und Entropieterme der Helixbildung bei der Hybridisierung mit einbezogen werden:
    $ T_\mathrm{M}=\frac{\Delta H \frac{\mbox{cal}}{\mbox{mol}}}{\Delta S+R \ln(\frac{\text{primer}}{2})}-273{,}15 \ ^\circ \mbox{C} $

Mittlerweile gibt es aber eine große Anzahl an Software, mit der man die Schmelztemperatur von Primern berechnen kann.

Degenerierte Primer

Degenerierte Primer werden verwendet, um mehrere homologe Gene (in verschiedenen Spezies) oder paraloge Gene (innerhalb einer Spezies) mit einem Primerpaar zu amplifizieren. Sie spielen auch eine entscheidende Rolle bei der de novo Sequenzierung von bislang unbekannten Gensequenzen, wenn also auch die Primer-Target-Sequenzen unbekannt sind.

Bei degenerierten Primern handelt es sich prinzipiell um ein Gemisch aus ähnlichen Primer-Sequenzen die in einem degeneriertem Code zusammengefasst werden. Degenerierte Primer können also auch dann noch auf eine Target-Sequenz passen, wenn diese sich im Laufe der Evolution verändert hat.

So steht beispielsweise die Sequenz

  • NTAACGTATGCGATATCGGS

für ein Gemisch der Sequenzen

  • ATAACGTATGCGATATCGGC
  • TTAACGTATGCGATATCGGC
  • GTAACGTATGCGATATCGGC
  • CTAACGTATGCGATATCGGC
  • ATAACGTATGCGATATCGGG
  • TTAACGTATGCGATATCGGG
  • GTAACGTATGCGATATCGGG
  • CTAACGTATGCGATATCGGG

Bei degenerierten Primern stellt das Primerdesign eine besondere Herausforderung dar. Primereigenschaften und mögliche Primer-Primer Interaktionen sowie mögliches Target-Mispriming müssen für jede der möglichen Sequenzen separat untersucht werden. Eine Vielzahl verschiedener Software Tools wurde speziell zum Design degenerierter Primer basierend auf Alignments oder Konsensus-Sequenzen entwickelt (z.B. easyPAC)

Weblinks

Diese Artikel könnten dir auch gefallen

Die letzten News

28.02.2021
Anthropologie | Genetik
64 menschliche Genome als neue Referenz für die globale genetische Vielfalt
Eine internationale Forschungsgruppe hat 64 menschliche Genome hochauflösend sequenziert.
28.02.2021
Neurobiologie | Insektenkunde
Wie Insekten Farben sehen
Insekten und ihre hochentwickelte Fähigkeit Farben zu sehen und zum Beispiel Blüten unterscheiden zu können, sind von zentraler Bedeutung für die Funktion vieler Ökosysteme.
28.02.2021
Genetik | Virologie
Retroviren schreiben das Koala-Genom um
Koalas sind mit zahlreichen Umwelt- und Gesundheitsproblemen konfrontiert, die ihr Überleben bedrohen.
26.02.2021
Ökologie | Paläontologie
Student entwickelt ein neues Verfahren, um Millionen Jahre alte Ökosysteme zu rekonstruieren
Niklas Hohmann, Masterstudent der Geowissenschaften an der Friedrich-Alexander-Universität Erlangen-Nürnberg (FAU), hat einen neuen Algorithmus entwickelt, mit dem sich die Abfolge von Ökosystemen durch die Erdgeschichte besser rekonstruieren lässt.
26.02.2021
Klimawandel | Biodiversität | Land-, Forst- und Viehwirtschaft
Unterirdische Biodiversität im Wandel
Durch den globalen Wandel wird die Vielfalt der Bakterien auf lokaler Ebene voraussichtlich zunehmen, während deren Zusammensetzung sich auf globaler Ebene immer ähnlicher wird.
25.02.2021
Botanik | Ökologie | Klimawandel | Video
Wald im Trockenstress: Schäden weiten sich weiter aus
Ergebnisse der Waldzustandserhebung 2020 zeigen: Die anhaltenden Dürrejahre fordern Tribut.
24.02.2021
Physiologie | Primatologie
Geophagie: Der Schlüssel zum Schutz der Lemuren?
Kürzlich wurde eine transdisziplinäre Forschung über die Interaktionen zwischen Böden und Darm-Mykobiom (Pilze und Hefen) der Indri-Indri-Lemuren veröffentlicht.
24.02.2021
Mikrobiologie | Evolution
Vom Beginn einer evolutionären Erfolgsstory
Unser Planet war bereits lange von Mikroorganismen besiedelt, bevor komplexere Lebewesen erstmals entstanden und sich nach und nach zur heute lebenden Tier- und Pflanzenwelt entwickelten.
24.02.2021
Genetik
Cre-Controlled CRISPR: konditionale Gen-Inaktivierung wird einfacher
Die Fähigkeit, ein Gen nur in einem bestimmten Zelltyp auszuschalten, ist für die modernen Lebenswissenschaften wesentlich.
24.02.2021
Land-, Forst- und Viehwirtschaft | Fischkunde
Bald nur noch ängstliche Fische übrig?
Über die Fischerei werden vor allem größere und aktivere Fische aus Populationen herausgefangen.
23.02.2021
Anthropologie | Neurobiologie
Placebos wirken auch bei bewusster Einnahme
Freiburger Forschende zeigen: Scheinmedikamente funktionieren auch ohne Täuschung. Probanden waren über Placebo-Effekt vorab informiert.
23.02.2021
Botanik | Klimawandel
Auswirkungen des Klimas auf Pflanzen mitunter erst nach Jahren sichtbar
Die Auswirkungen von Klimaelementen wie Temperatur und Niederschlag auf die Pflanzenwelt werden möglicherweise erst Jahre später sichtbar.
23.02.2021
Ökologie | Klimawandel
Biologische Bodenkrusten bremsen Erosion
Forschungsteam untersucht, wie natürliche „Teppiche“ Böden gegen das Wegschwemmen durch Regen schützen.
23.02.2021
Mikrobiologie | Meeresbiologie
Süße Algenpartikel widerstehen hungrigen Bakterien
Eher süß als salzig: Mikroalgen im Meer produzieren jede Menge Zucker während der Algenblüten.
21.02.2021
Evolution | Biochemie
Treibstoff frühesten Lebens – organische Moleküle in 3,5 Milliarden Jahre alten Gesteinen nachgewiesen
Erstmalig konnten biologisch wichtige organische Moleküle in archaischen Fluideinschlüssen nachgewiesen werden. Sie dienten sehr wahrscheinlich als Nährstoffe frühen Lebens auf der Erde.
21.02.2021
Evolution | Biochemie
Origin of Life - Begann die Darwin’sche Evolution schon, bevor es Leben gab?
Ehe Leben auf der Erde entstand, gab es vor allem eines: Chaos.
21.02.2021
Anthropologie | Neurobiologie
Kommunikationsfähigkeit von Menschen im REM-Schlaf
Mit schlafenden Versuchspersonen lassen sich komplexe Nachrichten austauschen. Das haben Wissenschaftler jetzt in Studien gezeigt.
21.02.2021
Paläontologie | Insektenkunde
Fossile Larven - Zeitzeugen in Bernstein
Eine ungewöhnliche Schmetterlingslarve und eine große Vielfalt an Fliegenlarven. LMU-Zoologen haben in Bernstein fossile Bewohner Jahrmillionen alter Wälder entdeckt.
21.02.2021
Ethologie | Ökologie
Wölfe in der Mongolei fressen lieber Wild- als Weidetiere
Wenn das Angebot vorhanden ist, ernähren sich Wölfe in der Mongolei lieber von Wildtieren als von Weidevieh.
21.02.2021
Meeresbiologie
Neuer Wohnort im Plastikmüll: Biodiversität in der Tiefsee
Ein internationales Forscherteam findet einen neuen Hotspot der Biodiversität – und zwar ausgerechnet im Plastikmüll, der sich seit Jahrzehnten in den Tiefseegräben der Erde ansammelt.
19.02.2021
Meeresbiologie | Land-, Forst- und Viehwirtschaft
Durch Aquakultur gelangt vom Menschen produzierter Stickstoff in die Nahrungskette
Ausgedehnte Aquakulturflächen entlang der Küsten sind in Südostasien sehr verbreitet.
19.02.2021
Anthropologie | Paläontologie
Das Aussterben der größten Tiere Nordamerikas wurde wahrscheinlich vom Klimawandel verursacht
Neue Forschungsergebnisse deuten darauf hin, dass die Überjagung durch den Menschen nicht für das Verschwinden von Mammuts, Riesenfaultieren und anderen nordamerikanischen Großtieren verantwortlich war.
18.02.2021
Anthropologie | Virologie
Neandertaler-Gene und Covid-19 Verläufe
Letztes Jahr entdeckten Forscher, dass wir den wichtigsten genetischen Risikofaktor für einen schweren Verlauf der Krankheit Covid-19 vom Neandertaler geerbt haben.
18.02.2021
Taxonomie | Fischkunde
Wüstenfische „under cover“ – neu entdeckte Vielfalt auf der arabischen Halbinsel
Das Landschaftsbild des Oman ist geprägt durch ausgedehnte Wüstenlandschaften und karge, trockene Hochgebirgsketten.
18.02.2021
Genetik | Immunologie | Biochemie
Rätsel des pflanzlichen Immunsystems gelöst
Wie bauen Pflanzen eine Resilienz auf? Ein internationales Forschungsteam hat die molekularen Mechanismen des pflanzlichen Immunsystems untersucht.